Infekcja i kolonizacja Clostridium difficile

Ważne jest zrozumienie roli leków w zapobieganiu infekcjom szpitalnym Clostridium difficile. Artykuł Loo i in. (3 listopada) 1 stawia dwa pytania. Po pierwsze, twierdzimy, że nie tylko narażenie pacjenta na leki może zwiększać ryzyko, ale także kultura przepisywania szpitala. Szpitale mają schematy przepisywania, które mogą zaostrzyć lub zminimalizować ryzyko infekcji szpitalnych. Zastanawiamy się, czy autorzy byli w stanie ocenić, w jakim stopniu zagregowane wzorce prze...

Cisnienie jazdy jako kluczowa zmienna wentylacyjna

Amato i in. (Wydanie z 19 lutego) stwierdza, że u pacjentów z zespołem ostrej niewydolności oddechowej (ARDS) występuje odwrotna zależność między podatnością układu oddechowego (Cr), która odzwierciedla funkcjonalny rozmiar płuc podczas choroby, a ciśnieniem jazdy (?P = Vt / Crs, gdzie Vt wskazuje objętość oddechową), który jest używany do wentylacji. Obniżenie ciśnienia napędowego wiązało się ze zwiększonym odsetkiem przeżycia w ich badaniu. Jednak funkcjo...

Polimorfizm w regionie promotora CTGF związany ze stwardnieniem rozsianym czesc 4

Jako startery zastosowano ATTGATGGCCACTCCTCCCTTGTCCTTGCC i odwrotną GGCAAGGACAAGGGAGGAGTGGCCATCAAT. Te dwa konstrukty zastosowano w przejściowych testach kotransfekcji, razem z pCMV-Sp3 (dostarczonym przez Guntram Suske), 20 lub kontrolą pustego wektora pCMV, jak opisano powyżej. Testy wiązania DNA
Dla EMSA, przygotowaliśmy ekstrakty jądrowe z ludzkich fibroblastów płuc, jak opisano uprzednio21 i wykorzystano te ekstrakty w reakcjach wiązania z znakowanymi 32P dwunici...

Ze swiata architektury - TOPOS Eco-Retail Development Proposal / Shift Architecture Urbanism

Bardzo niewielkie formalne szkolenie w zakresie rekompensat pracowniczych odbywa się w dzisiejszych programach szkolenia rezydentów, bez względu na specjalność. Większość lekarzy, którzy badają i leczą pacjentów objętych rekompensatą za pracę, dowiedzieli się o tej dziedzinie medycyny od starszych kolegów, z doświadczenia i własnych błędów. Kursy instruktażowe są oferowane przez renomowane organizacje podseksualne, ale przeciętny chirurg ortopeda, neurochirurg ...

Najnowsze zdjęcia w galerii telemed.org:

751#krioterapia miejscowa skutki uboczne , #za wysoki cholesterol całkowity , #po której stronie boli trzustka , #jak leczyć uzależnienia , #wyniki glukoza we krwi , #permanentny stres , #właściwa aktywność fizyczna polega na , #jagoda acai sok , #rudy szczur , #dr frąckowiak olsztyn ,