Polimorfizm w regionie promotora CTGF związany ze stwardnieniem rozsianym czesc 4

Jako startery zastosowano ATTGATGGCCACTCCTCCCTTGTCCTTGCC i odwrotną GGCAAGGACAAGGGAGGAGTGGCCATCAAT. Te dwa konstrukty zastosowano w przejściowych testach kotransfekcji, razem z pCMV-Sp3 (dostarczonym przez Guntram Suske), 20 lub kontrolą pustego wektora pCMV, jak opisano powyżej. Testy wiązania DNA
Dla EMSA, przygotowaliśmy ekstrakty jądrowe z ludzkich fibroblastów płuc, jak opisano uprzednio21 i wykorzystano te ekstrakty w reakcjach wiązania z znakowanymi 32P dwuniciowymi oligonukleotydami obejmującymi miejsce polimorficzne: oligonukleotydem allelowym najwyższej nici CATTGATGGCCACTCCTCCCTTGTCCTTGCC i oligonukleotydem oligonukleotydowym najwyższej nici CATTGATGGCCACTCGTCCCTTGTCCTTGCC. Zastosowaliśmy standardowe warunki zalecane przez producenta zestawu (Promega) i rozdzielono reakcje na 4% żelu poliakrylamidowym w 4 ° C i 160 V. Konsensusowe oligonukleotydy dla Sp1 i EGR1 zakupiono od Promega, i następujące przeciwciała zastosowano w testach supershift : Sp1 (sc-59X), Sp3 (sc-644X) oraz kozie i króliki IgG (Santa Cruz). Oznaczenie immunoprecypitacji chromatyny przeprowadzono za pomocą dostępnego w handlu zestawu (Upstate), zgodnie z instrukcjami producenta (patrz dodatek dodatkowy).
Analiza statystyczna
Częstotliwość genotypu i allelu określono przez bezpośrednie zliczanie. Częstotliwości genotypowe grup pacjentów i osób kontrolnych (w grupie 1, w grupie 2 iw grupie łączonej, bez uwzględnienia podgrup serologicznych i klinicznych) były w równowadze Hardy ego-Weinberga. Polimorfizm analizowano jako indywidualny marker bialleliczny w jednym locus. Zastosowaliśmy analizę chi-kwadrat, test chi-kwadrat Cochrana-Armitage a dla trendów oraz modele regresji logistycznej w celu porównania rozkładu genotypu G-945C wśród grup pacjentów i osób kontrolnych.
Przeprowadzono analizy logistycznej regresji wielomianowej (wielomianowej) z 500 osobami kontrolnymi jako poziomem podstawowym i dwoma możliwymi wynikami choroby (z określoną cechą lub bez niej) lub więcej niż dwie w przypadku przeciwciał, które wzajemnie się wykluczały. Regonalną regresję logistyczną wykorzystano również w analizie przypadku w celu zbadania związku między wykluczającymi się grupami serologicznymi, z grupą, która była ujemna zarówno dla anty-topoizomerazy I, jak i przeciwciał przeciw-mentromerowych, stosowanych jako grupa kontrolna. Ponieważ cechy kliniczne choroby niekoniecznie się wykluczały, analizowaliśmy ich powiązanie z genotypem G-945C w analizie przypadku z zastosowaniem modeli logistyczno-regresyjnych, w których rozkład genotypów u pacjentów, którzy prezentowali każdą cechę kliniczną w porównaniu z pacjentami bez tej cechy. Wyniki wyrażono jako iloraz szans i 95% przedział ufności. Obliczenia statystyczne przeprowadzono za pomocą oprogramowania statystycznego Stata (wersja 9).
Znaczenie różnicy między grupami genotypowymi w regionach promotor-reporter i immunoprecypitacją chromatyny oszacowano za pomocą dwustronnego testu t-Studenta (zakładając równą wariancję) za pomocą Excela (Microsoft).
Wyniki
Identyfikacja wariantów sekwencji
Region promotora CTGF w pobliżu pozycji -945 nie został funkcjonalnie scharakteryzowany, ale kontrola sekwencji i przeszukiwanie bazy danych16 wskazały, że podstawienie pojedynczej zasady w tym miejscu może wpływać na wiązanie DNA kilku czynników transkrypcyjnych, w tym sparowanego genu kodu 3 (Pax3), górny czynnik stymulujący (USF), mieloidalny palec cynkowy (MZF) i czynniki podobne do Sp1
[przypisy: ekovita częstochowa, antybiotyk zamur, alantavit ]