Polimorfizm w regionie promotora CTGF związany ze stwardnieniem rozsianym czesc 4

Jako startery zastosowano ATTGATGGCCACTCCTCCCTTGTCCTTGCC i odwrotną GGCAAGGACAAGGGAGGAGTGGCCATCAAT. Te dwa konstrukty zastosowano w przejściowych testach kotransfekcji, razem z pCMV-Sp3 (dostarczonym przez Guntram Suske), 20 lub kontrolą pustego wektora pCMV, jak opisano powyżej. Testy wiązania DNA
Dla EMSA, przygotowaliśmy ekstrakty jądrowe z ludzkich fibroblastów płuc, jak opisano uprzednio21 i wykorzystano te ekstrakty w reakcjach wiązania z znakowanymi 32P dwuniciowymi oligonukleotydami obejmującymi miejsce polimorficzne: oligonukleotydem allelowym najwyższej nici CATTGATGGCCACTCCTCCCTTGTCCTTGCC i oligonukleotydem oligonukleotydowym najwyższej nici CATTGATGGCCACTCGTCCCTTGTCCTTGCC. Zastosowaliśmy standardowe warunki zalecane przez producenta zestawu (Promega) i rozdzielono reakcje na 4% żelu poliakrylamidowym w 4 ° C i 160 V. Konsensusowe oligonukleotydy dla Sp1 i EGR1 zakupiono od Promega, i następujące przeciwciała zastosowano w testach supershift : Sp1 (sc-59X), Sp3 (sc-644X) oraz kozie i króliki IgG (Santa Cruz). Continue reading „Polimorfizm w regionie promotora CTGF związany ze stwardnieniem rozsianym czesc 4”

Wyniki w wieku 2 lat po wielokrotnych dawkach kortykosteroidów przedporodowych

Wcześniej donieśliśmy o wynikach randomizowanego, kontrolowanego badania, które wykazało, że powtarzane dawki kortykosteroidów przedporodowych zmniejszyły ryzyko wystąpienia zespołu zaburzeń oddechowych i poważnej choroby noworodkowej. Jednak dane nie były dostępne w odniesieniu do długoterminowych skutków tego leczenia. Metody
Kobiety, które otrzymały wstępny cykl leczenia kortykosteroidami 7 lub więcej dni wcześniej, zostały losowo przydzielone do wstrzyknięcia domięśniowego kortykosteroidu (11,4 mg betametazonu) lub placebo w postaci soli; dawkę powtarzano co tydzień, jeśli matka nadal była narażona na ryzyko przedwczesnego porodu, a czas trwania ciąży wynosił mniej niż 32 tygodnie. Ocenialiśmy przeżywalność wolną od poważnej niesprawności neurosensorycznej i wielkości ciała dzieci w wieku 2 lat z korektą.
Wyniki
Spośród 1085 dzieci, które żyły w wieku 2 lat, 1047 (96,5%) było ocenionych (521 poddanych działaniu kortykosteroidów powtarzanych i 526 wystawionych na działanie placebo). Continue reading „Wyniki w wieku 2 lat po wielokrotnych dawkach kortykosteroidów przedporodowych”

Długoterminowe wyniki po powtórnych dawkach kortykosteroidów przedporodowych ad 6

Inne badania wykazały podobny wpływ kortykosteroidów poporodowych, 23-25 wykazujących potencjalną podatność mózgu wcześniaków na wysokie dawki kortykosteroidów. Należy jednak zachować ostrożność podczas ekstrapolacji z badań ekspozycji na kortykosteroidy po urodzeniu. Stężenie kortykosteroidów w tych badaniach było wyższe, a okres ekspozycji dłuższy niż w badaniach dotyczących ekspozycji w okresie przedporodowym; ponadto w badaniach tych stosowano deksametazon, który może mieć inne działanie niż działanie betametazonu stosowanego w badaniach ekspozycji w okresie przedporodowym. Badania na zwierzętach wykazały również szkodliwy wpływ powtarzających się cykli kortykosteroidów przedporodowych na rozwój neuronów. Badania na owcach wykazały zmniejszoną wielkość mózgu, 26-28 zmieniony wzrost nerwów, opóźnione tempo mielinizacji, 29, 30 i zmieniony rozwój siatkówki.31 Podobnie, badania na małpach wykazały, że wiele kursów jest związanych zarówno ze zmniejszeniem liczby neuronów i zależne od dawki zwyrodnienie neuronów w hipokampie. Continue reading „Długoterminowe wyniki po powtórnych dawkach kortykosteroidów przedporodowych ad 6”

Możemy zrobić lepiej – polepszanie zdrowia Amerykanów ad

Nawet gdyby cała ludność Stanów Zjednoczonych miała dostęp do doskonałej opieki medycznej – a tego nie robi – można by zapobiec tylko niewielkiej części tych zgonów. Największą szansą na poprawę zdrowia i ograniczenie przedwczesnych zgonów jest zachowanie osobiste. W rzeczywistości zachowania behawioralne stanowią prawie 40% wszystkich zgonów w Stanach Zjednoczonych.12 Chociaż nie było zgody co do faktycznej liczby zgonów, które można powiązać z otyłością i brakiem aktywności fizycznej, oczywiste jest, że ta para czynników i palenie tytoniu to dwie najważniejsze behawioralne przyczyny przedwczesnej śmierci (wykres 2) .12 Przeciwdziałanie niezdrowemu zachowaniu
Lekarze i decydenci mogą kwestionować, czy zachowanie jest podatne na zmiany, czy też próby zmiany zachowania leżą poza zasięgiem tradycyjnej opieki medycznej.13 Mogą oczekiwać, że przyszłe sukcesy będą zgodne ze wzorcem, w którym szczepienia i antybiotyki poprawiły zdrowie w XX wieku. Jeżeli zdrowie społeczeństwa ma się poprawić, to poprawa jest bardziej prawdopodobna ze zmiany zachowań niż z innowacji technologicznych. Doświadczenie pokazuje, że w rzeczywistości można zmienić zachowanie, co ilustruje zwiększone użycie pasów bezpieczeństwa i zmniejszone zużycie produktów o dużej zawartości tłuszczów nasyconych. Continue reading „Możemy zrobić lepiej – polepszanie zdrowia Amerykanów ad”

Możemy zrobić lepiej – polepszanie zdrowia Amerykanów

Stany Zjednoczone wydają więcej na opiekę zdrowotną niż jakikolwiek inny naród na świecie, ale są słabo wyposażone w prawie każdy stan zdrowia. Jak to może być. Co tłumaczy ten oczywisty paradoks. Dwuczęściowa odpowiedź jest zwodniczo prosta – po pierwsze, ścieżki do lepszego zdrowia zazwyczaj nie zależą od lepszej opieki zdrowotnej, a po drugie, nawet w tych przypadkach, w których opieka zdrowotna jest ważna, zbyt wielu Amerykanów jej nie otrzymuje, także ją otrzymają późno, lub otrzymują opiekę niskiej jakości. W tym wykładzie najpierw podsumowuję Stany Zjednoczone w międzynarodowych rankingach stanu zdrowia. Continue reading „Możemy zrobić lepiej – polepszanie zdrowia Amerykanów”

Rozpoznanie niedoboru jodu w rodowitych rodach jodu

Zaburzenia niedoboru jodu są powszechne w regionach o niskim poziomie jodu, ale generalnie zostały wyeliminowane w krajach zamożnych poprzez powszechne stosowanie soli jodowanej. 1-4 Mamy relację o dwóch kobietach, oboje na całe życie w Stanach Zjednoczonych, u których niedobór jodu zaburzenia rozwinęły się.
Tabela 1. Tabela 1. Charakterystyka kliniczna i laboratoryjna pacjentów podczas prezentacji. Continue reading „Rozpoznanie niedoboru jodu w rodowitych rodach jodu”

Całkowita wymiana stawu kolanowego Ból i niepełnosprawność Ilustrowany przewodnik po więzadełach KneeKnee: Badanie kliniczne ad

Na przykład w rozdziale dotyczącym uszkodzeń łąkotki nie ma dyskusji o naprawie łąkotki. Co więcej, Cailliet sugeruje, że większość urządzeń total-knee-replacement opiera się na konstrukcji Walldius, która nie jest już używana. Wreszcie, dyskusja na temat leczenia złamań wokół kolana jest ograniczona tylko technikami chirurgicznymi, które są obecnie uważane za standardowe w przypadku większości złamań złamanych wokół kolana. Książka Cailliet z pewnością nie jest wykorzystywana przez ortopedów lub ich mieszkańców, a dyskusje na temat zalecanego leczenia powinny być ostrożnie stosowane przez lekarzy pierwszego kontaktu – szczególnie w odniesieniu do traumatycznych zmian w kolanie.
Natomiast Ilustrowany przewodnik po kolanie Trii i Kleina dostarcza w znacznie bardziej zwięzłej i logicznej formie podstawowych faktów związanych z kolanem i jego wieloma dolegliwościami. Continue reading „Całkowita wymiana stawu kolanowego Ból i niepełnosprawność Ilustrowany przewodnik po więzadełach KneeKnee: Badanie kliniczne ad”

Całkowita wymiana stawu kolanowego Ból i niepełnosprawność Ilustrowany przewodnik po więzadełach KneeKnee: Badanie kliniczne

Te cztery książki mają jako swój wspólny przedmiot największy, najbardziej złożony staw w ludzkim ciele – kolano. Poza tym ich koncentracja i zamierzona publiczność są zupełnie inne. Książka wydana przez Laskina dotyczy pojedynczej procedury operacyjnej, całkowitej wymiany stawu kolanowego. Laskin zebrał 23 autorów, którzy omówili wszystkie aspekty operacji wymiany stawu kolanowego. Książka zawiera cztery główne sekcje i zawiera 228 ilustracji i ilustracji. Continue reading „Całkowita wymiana stawu kolanowego Ból i niepełnosprawność Ilustrowany przewodnik po więzadełach KneeKnee: Badanie kliniczne”

Podręcznik i Atlas Cytologii Aspiracyjnej Drobnej Igły

Przeglądając wystawę książek ostatniego dnia spotkania patologii kilka lat temu, wziąłem ten podręcznik w jego pierwszej edycji. Byłem pod wrażeniem pięknych kolorowych fotografii i praktycznego podejścia do problemów diagnostycznych. Jednak cena była nieco stroma dla mojego nieco ograniczonego budżetu, a ja z żalem zastąpiłem książkę na półce. Sprzedawca, być może chcąc spakować mniej książek, zaoferował mi dość dużą zniżkę, którą natychmiast z wdzięcznością przyjąłem. Książka stała się niezwykle przydatna w kolejnych latach. Continue reading „Podręcznik i Atlas Cytologii Aspiracyjnej Drobnej Igły”

HMO i lekarze bez certyfikatu zarządu

Praktyka organizacji zajmujących się utrzymaniem zdrowia (HMO) wymagająca certyfikacji przez lekarzy biorących udział w badaniu stała się ważnym czynnikiem wpływającym na dostęp do opieki zdrowotnej w Massachusetts i innych częściach Stanów Zjednoczonych.
Kiedy po raz pierwszy pojawiła się zarządzana opieka, HMO zgłosiły lekarzy, a następnie wykorzystali te spisy, aby promować swoje plany. Jednocześnie opracowali kryteria kwalifikacyjne, które zazwyczaj obejmowały informacje na temat szkoleń i licencjonowania, certyfikacji forum i błędów w posługiwaniu się błędami. Następnie HMO zaczęli podkreślać w swoich marketingach, że na swoich panelach mieli jedynie certyfikowanych lekarzy, co sugeruje, że to ograniczenie określa lepszy plan.
Ponieważ w Stanach Zjednoczonych rozwinęła się opieka zdro wotna i zaczęto wykluczać lekarzy, którzy nie posiadają certyfikatu zarządu, niektórzy lekarze musieli opuścić praktykę. Continue reading „HMO i lekarze bez certyfikatu zarządu”