Sprawa 34-2011: Czlowiek z utrata pamieci i czesciowymi napadami padaczkowymi

W aktach sprawy, Cash i współpracownicy (wydanie 10 listopada) opisują przypadek limbicznego zapalenia mózgu z przeciwciałami na bogatą w leucynę dezaktywację glejaka 1 (LGI1) u 75-letniego mężczyzny z amnezją i nawracającymi napadami drgawek. Niektóre opisane napady wydają się podobne do napadów dystrakcyjnych faczobrachialnych . 2 Takie napady mają charakterystyczne objawy i występują niemal wyłącznie w związku z przeciwciałami LGI1.
Chociaż objawy napadów w opisywanym przypadku sugerowały czasem bardziej typową epilepsję skroniową, 3, 4 napady padaczkowe charakteryzowały się drgawkami twarzy, dyzartriami i posturami ręki. Cechy te są zgodne z podstawowymi charakterystycznymi cechami fakijocząstkowych napadów dystonicznych; mianowicie często powtarzające się postawy dystoniczne ramienia, twarzy lub obu. Ta postawa trwa tylko kilka sekund i przerywa zadania motoryczne i mowę, ale bez zmienionej świadomości.2 Epizody te wydają się by ć wywołane przez stres, skojarzenie opisane również przez Irani i współpracowników. Continue reading „Sprawa 34-2011: Czlowiek z utrata pamieci i czesciowymi napadami padaczkowymi”

Oddechowe dotlenienie blony w przypadku ARDS u doroslych

Podsumowując zastosowanie pozaustrojowej oksygenacji membranowej (ECMO) w ostrym zespole zaburzeń oddechowych (ARDS), Brodie i Bacchetta (wydanie 17 listopada) 1 sugerują, że ECMO jest bardziej etnograficznym alternatywnym podejściem do standardowej żylno-żylnej ECMO, gdy potrzebne jest wsparcie hemodynamiczne.
Z naszego doświadczenia wynika, że ??praktyka ta wiąże się ze znacznym ryzykiem. Po pierwsze, z powodu kaniuli tętnicy, perfuzja do chorej kończyny jest upośledzona, a niedokrwienie kończyny może wystąpić nawet u 21% pacjentów.2 Po drugie, ze względu na znacznie zmniejszony przepływ krwi przez krążenie płucne, możliwe jest utworzenie skrzepu.3 Wreszcie, co najważniejsze, dopływ krwi do krążenia ogólnoustrojowego w tej sytuacji jest podwójny: natleniona krew dostaje się do aorty zstępującej z obwodu ECMO, podczas gdy (w przeciwieństwie do krążenia pozaustrojowego) słabo natleniona krew jest nadal wyrzucana przez lewą komorę. W rez ultacie, więcej narządów czaszki, takich jak mózg i mięsień sercowy, otrzymuje słabo natlenioną krew w porównaniu z narządami ogonowymi dostarczanymi przez zstępującą aortę, które otrzymują dobrze natlenioną krew.4,5 Dlatego zalecamy, aby unikać ECO optymalnego krążenia w ARDS .
Hergen Buscher, FCICM
Priya Nair, FCICM
Szpital św. Wincentego, Sydney, NSW, Australia
de
Nie zgłoszono żadnego potencjalnego konfliktu interesów związanego z tym pismem. Continue reading „Oddechowe dotlenienie blony w przypadku ARDS u doroslych”

Oligonukleotyd antysensowny XIX dla zakrzepicy zylnej

Chciałbym przestrzec przed wnioskiem, na podstawie badań Büller i in. (Wydanie 15 stycznia), że obniżenie poziomu czynnika XI zmniejsza ryzyko zakrzepicy bez zwiększania ryzyka krwawienia. Niedobór czynnika XI selektywnie zwiększa ryzyko krwawienia w tkankach o wysokiej aktywności fibrynolitycznej, takich jak po chirurgii stomatologicznej, wycięciu migdałków lub chirurgii prostaty oraz w stanie poporodowym.2.3 Trombina wytwarzana przez wewnętrzną ścieżkę jest głównie odpowiedzialna za aktywację aktywowanej trombiny inhibitor fibrynolizy (TAFI). W przypadku braku czynnika XI, a zatem TAFI, skrzep powstający w tkankach o wysokiej aktywności fibrynolitycznej jest kruchy i mało prawdopodobne, aby zapewnić trwałą hemostazę. [5] Dlatego wyniki uzyskane podczas alloplastyki stawu kolanowego nie podlegają uogólnieniu na te tkanki śluzówki. Anindya Gupta, MD, Ph.D. Continue reading „Oligonukleotyd antysensowny XIX dla zakrzepicy zylnej”

Trwale i pojawiajace sie wyzwania swiadomej zgody

Wskaźniki czytelności i poziomy wykształcenia są niezbędne do zrozumienia standardowych formularzy zgody po wyrażeniu zgody w Wielkiej Brytanii, Austrii, Niemczech i Szwajcarii. W swoim artykule przeglądowym, Grady (wydanie z 26 lutego) podkreśla lukę między teorią a praktyką w uzyskiwaniu świadomej zgody. Jednak rozmiar tej rozbieżności wydaje się obecnie bardziej istotny niż oczekiwano. Do 2003 r. Czytelność formularzy świadomej zgody, które zostały dostarczone przez instytucjonalne komisje rewizyjne, nie spełniała standardów, zgodnie z formułą Flesch-Kincaid.2,3. Używając tej formuły przeanalizowaliśmy bieżące szablony formularzy świadomej zgody brytyjska krajowa służba zdrowia, jak również komisje etyczne i organizacje patronackie w Austrii, Niemczech i Szwajcarii. Continue reading „Trwale i pojawiajace sie wyzwania swiadomej zgody”

Zdrowie, bogactwo i Senat USA

Ustawa o pogodzie na rzecz lepszej opieki (BCRA), jak nazywa Senat USA, rachunek za opiekę zdrowotną wydany w zeszłym tygodniu przez małą grupę republikańskich senatorów, nie ma na celu zapewnienia lepszej opieki Amerykanom. Podobnie jak w ustawie House, która została uchwalona na początku maja, amerykańska Ustawa o Opiece Zdrowotnej (AHCA), w rzeczywistości zrobiłaby coś przeciwnego: zmniejszyć liczbę osób z ubezpieczeniem zdrowotnym o około 22 miliony, podnieść koszty ubezpieczenia o kolejne miliony i dać państwom możliwość zezwolenia ubezpieczycielom na pominięcie ochrony wielu krytycznych usług opieki zdrowotnej, tak aby pacjenci cierpiący na kosztowne choroby, wcześniej istniejący lub w inny sposób, byli w znacznym stopniu niedostatecznie ubezpieczeni i obarczeni dławiącymi się płatnościami bez zapłaty – wszystko z przewidywalnie niszczycielskimi skutkami dla zdrowia i życia Amerykanów. W ramach BCRA lepiej byłoby ustawą podatkową dla bogatych osób, która w ciągu następnej dekady zmniejszyłaby się o setki miliardów dolarów – około 5000 USD rocznie dla rodzin zarabiających ponad 200 000 USD rocznie i 50 000 USD lub więcej dla tych osób zarabiając ponad milion dolarów, zgodnie z analizą AHCA, która zawierała podobne zestawienie przepisów podatkowych1. Uważamy, że ten kompromis nie jest tym, do którego powinniśmy się pogodzić – lekarzy, pacjentów czy społeczeństwo amerykańskie. W ramach BCRA państwa mogłyby łatwo otrzymać zwolnienia, aby znieść wiele przepisów ubezpieczeniowych stworzonych przez Ustawę o przystępnej cenie (ACA). Chociaż wymóg ACA, że ubezpieczyciele przyjmą wszystkich chętnych, nominalnie pozostanie nienaruszony, państwa mogą odrzucić obowiązkowe podstawowe świadczenia ACA, pozwalając ubezpieczycielom odmówić pokrycia takich krytycznych usług, takich jak pomoc doraźna, opieka psychiatryczna, opieka położnicza, chemioterapia i leki na receptę, między innymi inni. Continue reading „Zdrowie, bogactwo i Senat USA”

Zaniedbana epidemia AD 2

W połowie dystryktów kontakty z pacjentami wskaźnikowymi były aktywnie monitorowane przez badanie fizykalne, radiografię klatki piersiowej, rozmaz plwociny i hodowlę w 6, 12 i 24 miesiącu. Względne ryzyko wykrycia gruźlicy w grupie interwencyjnej w porównaniu z grupą kontrolną wynosiło 2,5 spośród wszystkich kontaktów i 6,4 wśród osób z dodatnim wymazem plwociny. Jest to ważne nowe odkrycie i dostarcza formalnego dowodu w warunkach dużego obciążenia, że aktywne rozpoznawanie przypadków może wykrywać wczesne i bezobjawowe przypadki gruźlicy skuteczniej niż obecna strategia. Gruźlica to nie tylko problem choroby; jest to problem systemu opieki zdrowotnej. Kiedy przed diagnozą pacjenci muszą zobaczyć trzech dostawców, a tylko jedna czwarta lekarzy rozpoznaje kardynalne objawy gruźlicy lub zna standardową terapię, istnieje poważny problem systemu zdrowotnego.7 Wzmocnienie systemów opieki zdrowotnej w diagnostyce i leczeniu gruźlicy w krajach o dużym obciążeniu ma kluczowe znaczenie dla wyginania krzywej występowania gruźlicy i może służyć jako model dla innych chorób wymagających długotrwałego leczenia, w tym HIV / AIDS, chorób układu krążenia i cukrzycy.
Jednym z powodów spadku liczby przypadków malarii i zakażenia wirusem HIV jest to, że pracownicy służby zdrowia dysponują narzędziami, które nie są dostępne w walce z gruźlicą. Continue reading „Zaniedbana epidemia AD 2”

Regulacja urządzeń medycznych w Stanach Zjednoczonych i Unii Europejskiej AD 7

Opracowanie urządzenia medycznego: od prototypu do zatwierdzenia przez organ nadzoru. Circulation 2004; 109: 3068-3072 Crossref Web of Science Medline
38. Webb JG, Carere RG, Virmani R i in. Odzyskiwanie i analiza cząstek stałych po interwencji przeszczepu żyły odpiszczelowej. J Am Coll Cardiol 1999; 34: 468-475
Crossref Web of Science Medline
39. Baim DS, Wahr D, George B, i in. Continue reading „Regulacja urządzeń medycznych w Stanach Zjednoczonych i Unii Europejskiej AD 7”

Przypadek medyczny do urządzenia ad

Firma Medtronic twierdzi, że biorąc pod uwagę rygor procesu zatwierdzania przez FDA, wszelkie działania na poziomie państwowym, w tym postępowanie sądowe przeciwko firmie, będą stanowić kolejne wymaganie, a zatem będą podlegały wywłaszczaniu na podstawie §360k (a) Poprawek do Urządzeń Medycznych. Firma Medtronic argumentuje w istocie, że przyznanie zgody FDA chroni producenta urządzeń przed państwową odpowiedzialnością za szkody. Kongres długo i ciężko pracował nad reformą FDA w jej misji na rzecz poprawy bezpieczeństwa narkotyków i urządzeń medycznych. Kontrola Kongresu FDA wzbudziła poważne wątpliwości, czy agencja ma autorytet i zasoby niezbędne do wykonywania swojej pracy. Niedawne sprawozdanie z Biura Generalnego Inspektora Departamentu Zdrowia i Opieki Społecznej wzmocniło tę obawę4. Continue reading „Przypadek medyczny do urządzenia ad”

Polimorfizm w regionie promotora CTGF związany ze stwardnieniem rozsianym czesc 4

Jako startery zastosowano ATTGATGGCCACTCCTCCCTTGTCCTTGCC i odwrotną GGCAAGGACAAGGGAGGAGTGGCCATCAAT. Te dwa konstrukty zastosowano w przejściowych testach kotransfekcji, razem z pCMV-Sp3 (dostarczonym przez Guntram Suske), 20 lub kontrolą pustego wektora pCMV, jak opisano powyżej. Testy wiązania DNA
Dla EMSA, przygotowaliśmy ekstrakty jądrowe z ludzkich fibroblastów płuc, jak opisano uprzednio21 i wykorzystano te ekstrakty w reakcjach wiązania z znakowanymi 32P dwuniciowymi oligonukleotydami obejmującymi miejsce polimorficzne: oligonukleotydem allelowym najwyższej nici CATTGATGGCCACTCCTCCCTTGTCCTTGCC i oligonukleotydem oligonukleotydowym najwyższej nici CATTGATGGCCACTCGTCCCTTGTCCTTGCC. Zastosowaliśmy standardowe warunki zalecane przez producenta zestawu (Promega) i rozdzielono reakcje na 4% żelu poliakrylamidowym w 4 ° C i 160 V. Konsensusowe oligonukleotydy dla Sp1 i EGR1 zakupiono od Promega, i następujące przeciwciała zastosowano w testach supershift : Sp1 (sc-59X), Sp3 (sc-644X) oraz kozie i króliki IgG (Santa Cruz). Continue reading „Polimorfizm w regionie promotora CTGF związany ze stwardnieniem rozsianym czesc 4”

Długoterminowe wyniki po powtórnych dawkach kortykosteroidów przedporodowych czesc 4

Procedurę Wei-Lachina zastosowano do zmiennych ciągłych, biorąc pod uwagę potencjalną korelację wyników dla par bliźniąt.12 Do oceny jednorodności ilorazów szans zastosowano test Breslow-Day. Nominalna dwustronna wartość P mniejsza niż 0,05 została uznana za wskazującą na istotność statystyczną; nie dokonano żadnych korekt w przypadku wielokrotnych porównań. Wyniki
Rysunek 1. Rysunek 1. Grupa analityczna. Continue reading „Długoterminowe wyniki po powtórnych dawkach kortykosteroidów przedporodowych czesc 4”